Home > Banco de Questões > Biologia > Simulados

Citologia V

Lista de 15 exercícios de Biologia com gabarito sobre o tema Citologia com questões de Vestibulares.



01. (UCPEL) O desenvolvimento da microscopia (de luz e eletrônica) permitiu aos pesquisadores elaborar sofisticados modelos da organização interna da célula e de seus componentes, como na imagem abaixo.

________________ são organelas que estão presentes nas células vegetais em grande abundância e podem ser entendidos como uma região expandida do retículo endoplasmático. Em células animais é rara a presença de _________________, só podendo ser vista em células do tecido adiposo, pois estas terão _____________ que servem como reserva energética, armazenando gordura.

Os espaços devem ser preenchidos pela organela representada pelo número

  1. 10
  2. 7
  3. 3
  4. 11
  5. 8

02. (EMESCAM) André resolveu presentear a sua amiga por ocasião do seu casamento. Para isso, foi até uma loja de departamentos e, na seção de eletrodomésticos, comprou uma cafeteira automática. Após realizar o pagamento, dirigiu-se à seção de endereçamento e solicitou que fosse providenciada a entrega do presente no endereço correto.

Supondo comparar-se a loja com uma célula eucariota, o referido setor de endereçamento estaria localizado no (a)

  1. lisossomo.
  2. retículo endoplasmático granular.
  3. peroxissomo.
  4. mitocôndria.
  5. complexo de Golgi.

03. (UFAM PSC) Sobre os processos celulares é CORRETO afirmar que:

  1. para cada uma das milhares de proteínas diferentes que produzimos, há um ribossomo específico que direciona o destino final da proteína.
  2. toda a síntese proteica é citosólica, nenhum outro compartimento celular tem essa habilidade.
  3. todas as células humanas adultas apresentam pelo menos um envoltório nuclear.
  4. proteínas recém-sintetizadas são lançadas no retículo endoplasmático, processadas, encaminhadas até o Golgi, empacotadas em vesículas e exocitadas.
  5. estereocílios possuem a mesma organização molecular dos cílios

04. (CN) A divisão celular é o processo que ocorre nos seres vivos por meio do qual uma célula, chamada célula-mãe, divide-se em células-filhas, com informações genéticas relativas à espécie. Dependendo do tipo de célula, esta se dividirá por mitose ou por meiose, eventos complexos que fazem . parte do ciclo celular.

A mitose é importante por diversos motivos, EXCETO porque

  1. substitui as células mortas por outras novas.
  2. regenera as partes lesadas do organismo.
  3. as células-filhas são geneticamente diferentes da célula-mãe.
  4. são as células somáticas que fazem esse tipo de divisão celular.
  5. ocorre tanto com células haploides quanto com células diploides.

05. (URCA) Embora o coloide citoplasmático seja uma substância de fácil dispersão de substâncias, existe um conjunto membranoso responsável pelo transporte intracelular nas células eucariontes. Esse conjunto membranoso é denominado de:

  1. Complexo de Golgi
  2. Retículo endoplasmático
  3. Vacúolo
  4. Ribossomo
  5. Mitocôndria

06. (UNICAMP) A figura a seguir ilustra fragmentos de um gene presente em 4 espécies identificadas com os números de 1 a 4 entre parênteses.

CACTTGTAAAACCAGTATAGACCCTAG (1)

CACTTGTAAAACCAGGATAGACGCTAG(2)

CACTTGTAAAACCAGTATAGACGCTAG (3)

CATTTTTAACACCAGGATAGACGCTAT(4)

Assinale a alternativa correta.

  1. As espécies 1 e 4 são mais próximas entre si do que as espécies 1 e 3.
  2. As espécies 2 e 3 são mais próximas entre si do que as espécies 1 e 3.
  3. As espécies 1 e 3 são mais próximas entre si do que as espécies 3 e 4.
  4. As espécies 2 e 4 são mais próximas entre si do que as espécies 1 e 2.

07. (URCA) As células animais e vegetais possuem uma série de estruturas que tiveram a mesma origem no processo de evolutivo, mostrando que esses dois grupos possuem origem em um ancestral primordial. Contudo, durante o estabelecimento dos dois grupos, estruturas intracelulares se desenvolveram e passaram a ser exclusivas de cada um dos grupos citados acima. Assinale a alternativa que possui apenas estruturas encontradas em células vegetal e ausente na maioria dos outros grupos de seres vivos.

  1. Parede celular e cloroplastos
  2. Cloroplastos e ribossomos
  3. Centríolos e cloroplastos
  4. Drusa e mitocôndrias
  5. Parede celular e retículo endoplasmático

08. (UCPEL) O esquema abaixo representa os tipos de transporte pela membrana.

Podemos afirmar que no tipo de transporte indicado pelo número

  1. 2, moléculas e íons tendem a seguir o seu próprio gradiente e ir em direção à região onde estão menos concentrados. A intensidade do gradiente, temperatura, tamanho do soluto, carga e pressão influenciam nessa taxa de transporte.
  2. 1, os transportadores passivos permitem que íons ou moléculas pequenas atravessem uma membrana até o lado onde são menos concentrados. Como exemplo temos a bomba de sódio e potássio.
  3. 1, uma proteína bombeia um soluto ao longo de uma membrana, contra seu gradiente de concentração. O transportador deve ser ativado, normalmente por um aporte de energia do ATP. Como exemplo temos transportador de glicose.
  4. 2, um soluto se vincula a uma proteína que o libera no lado oposto da membrana. Nenhuma energia é necessária; o movimento líquido de soluto é para abaixo de seu gradiente de concentração.
  5. 2, os transportadores ativos bombeiam íons ou moléculas através de membranas para o lado onde são mais concentrados. Exigem entrada de energia como do ATP.

09. (URCA) Um filamento de DNA tem a seguinte sequência de bases nitrogenadas: ATT CGT CGC CCA. Caso essa sequência seja produtora de um filamento de RNA, essa sequência será:

  1. ATT CGT CGC CCA
  2. CCA CGC CGU ATT
  3. TAA GCA GCG GGA
  4. UAA GCA GCG GGU
  5. UAA GCA GGU GGU

10. (FAMP) Os lisossomos são bolsas membranosas intracelulares que contêm enzimas capazes de digerir grande variedade de substâncias orgânicas. Assinale a alternativa que explica CORRETAMENTE a função heterofágica e autofágica dos lisossomos.

  1. A função dos lisossomos é promover a digestão intracelular. A atuação dos lisossomos na digestão de partículas vindas de fora da célula é denominada função heterofágica.
  2. Os lisossomos também atuam na digestão de partes da própria célula em que se encontram, o que é denominado função autofágica. As células animais e vegetais reciclam seus componentes por meio desse processo formando vacúolos autofágicos.
  3. Um exemplo de heterofagia ocorre durante a metamorfose dos anfíbios, em que a cauda do girino regride em decorrência da digestão de suas células pelas enzimas lisossômicas.
  4. A atividade lisossômica autofágica se dá por fagocitose ou pinocitose, como é o caso dos macrófagos e certos tipos de glóbulo branco do sangue que capturam bactérias e outros agentes invasores de nosso corpo, defendendo-o de infecções.

11. (URCA) A membrana que delimita o espaço intracelular do extracelular é formada por uma bicamada lipídica, contendo proteínas e glicoproteínas, que desempenham diversas funções importantes na manutenção do compartimento celular. Dentre as principais funções da membrana plasmática estão corretas as alternativas abaixo, exceto:

  1. A membrana plasmática é responsável pela seletividade de compostos que entram e/ou saem do interior da célula.
  2. A membrana plasmática atua como meio de comunicação entre as diversas células.
  3. A membrana plasmática é responsável pela organização intracelular pois fixa algumas estruturas como mitocôndria, retículos endoplasmático e complexo de Golgi.
  4. A membrana plasmática separa os constituintes intracelulares do meio extracelular.
  5. A membrana plasmática atua no processo de sinalização celular.

12. (FAMP) Observe a tabela do código genético.

Assinale a alternativa contendo os códons a que os aminoácidos a seguir correspondem.

LEUCINA, ISOLEUCINA, LEUCINA, VALINA, SERINA, ALANINA.

  1. CUC AUU UAU GUA GAC CGC
  2. CUC AUC UUA GUA AGC GCG
  3. CUG AUA AAU GUC UGA GCA
  4. CUA CUG CUU CUG UCA GAC

13. (URCA) Trypanosomatidae é a família de protozoários que apresentam apenas um flagelo e dentre seus membros, destacam-se a Leishmania sp. e o Trypanosoma cruzi, agentes causadores da Leishmaniose (Calazar) e Doença de Chagas, respectivamente. Qual das organelas abaixo é destaque por ser única em cada parasita e por ser considerada alvo de diversos medicamentos?

  1. Complexo de Golgi
  2. Mitocôndria
  3. Retículo Endoplasmático
  4. Hidrogenossomos
  5. Peroxissomos

14. (UFJF) Uma importante característica da meiose é que ela promove variabilidade genética.

Sobre esta característica da meiose, é CORRETO afirmar que

  1. a maior causa dessa variabilidade genética é a permutação (crossing-over).
  2. a variabilidade genética vai depender do número de células filhas produzidas.
  3. a variabilidade genética vai depender da fase em que a permutação (crossing-over) ocorrer.
  4. o pareamento de cromossomos homólogos na prófase II da meiose é fundamental para que ocorra variabilidade genética.
  5. a maior fonte de variabilidade genética é a distribuição aleatória de cromossomos paternos e maternos nas células filhas.

15. (Mackenzie)

O esquema representa um modelo de organização da membrana plasmática. A respeito dele, assinale a alternativa correta.

  1. Essa organização é encontrada somente em células eucarióticas.
  2. A substância apontada em 1 ocupa local fixo na membrana.
  3. As membranas que compõem organelas celulares apresentam apenas uma camada de fosfolipídios.
  4. A seta 2 indica carboidratos que compõem o glicocálix.
  5. A substância apontada em 1 está envolvida apenas em transportes ativos.

Você acredita que o gabarito esteja incorreto? Avisa aí 😰| Email ou WhatsApp



.