Home > Banco de Questões > Biologia > Genética >Anemia Falciforme

Anemia Falciforme

Lista de 10 exercícios de Biologia com gabarito sobre o tema Anemia Falciforme com questões de Vestibulares.


Você pode conferir as videoaulas, conteúdo de teoria, e mais questões sobre o tema Anemia Falciforme.



01. (Unicamp) A anemia falciforme é uma doença hereditária que se caracteriza pelo formato de foice adquirido pelas hemácias depois que o oxigênio é liberado, resultando em anemia crônica.

Apresenta-se a seguir parte do RNA mensageiro, com o códon de iniciação, da subunidade β da hemoglobina humana normal (Hbb) e da hemoglobina mutada na anemia falciforme (HbS).

Hbb: caa aca gac acc aug gug cau cug acu ccu gag gag aag ucu

HbS: caa aca gac acc aug gug cau cug acu ccu gug gag aag ucu

Considere a sequência de trincas apresentadas, em Hbb e HbS, e o código genético abaixo.

  1. altera a 11a posição de aminoácidos, trocando leucina por histidina.
  2. altera a 7a posição de aminoácidos, trocando ácido glutâmico por valina.
  3. altera a 11a posição de aminoácidos, trocando ácido glutâmico por valina.
  4. altera a 7a posição de aminoácidos, trocando leucina por histidina.

02. (Mackenzie) A anemia falciforme é uma condição genética na qual há a substituição de um aminoácido na cadeia que compõe a hemoglobina. A esse respeito, considere as seguintes afirmativas:

I. Nessa condição, as hemácias se apresentam deformadas.

II. A substituição do aminoácido altera apenas a estrutura quaternária da molécula.

III. A substituição de um único nucleotídeo na cadeia de DNA pode resultar em condições como essa.

Assinale a alternativa correta.

  1. Apenas a afirmativa I está correta.
  2. Apenas as afirmativas I e III estão corretas.
  3. Apenas a afirmativa III está correta.
  4. Apenas as afirmativas II e III estão corretas.
  5. Todas as afirmativas estão corretas.

03. (UFVJM) A anemia falciforme é uma doença originada de um tipo de mutação gênica, de herança homozigótica, que altera a função protéica gerando moléculas defeituosas de hemoglobina. As hemácias apresentam um aspecto de foice e perdem a mobilidade e flexibilidade e são mais rígidas. Por esse motivo têm dificuldade para passar pelos vasos sanguíneos não realizando o transporte de oxigênio de maneira eficiente para os tecidos. Indivíduos que apresentam essa doença têm como sintoma mais comum o cansaço, porém, nos casos mais graves as hemácias podem se romper levando-o à morte.

Esse tipo de anemia induz cansaço porque

  1. os tecidos perdem a mobilidade e flexibilidade.
  2. os tecidos não recebem quantidades suficientes de O2.
  3. o tecido sanguíneo apresenta menor quantidade de hemoglobina.
  4. os tecidos não recebem nutrientes suficientes para sua manutenção.

04. (FCMS/JF) A anemia falciforme é uma doença que possui uma particularidade em regiões onde a malária é endêmica. Nessas regiões, existe um efeito letal da anemia falciforme nos portadores do genótipo ss, além do efeito letal da malária que geralmente ocorre nos portadores do genótipo SS. No entanto, indivíduos com a constituição genotípica Ss, normalmente não são afetados pela anemia falciforme e são resistentes a malária, sendo então encontrados com maior frequência nessas populações.

O texto acima se refere a um exemplo de:

  1. Seleção disruptiva
  2. Seleção direcional
  3. Seleção regional
  4. Seleção estabilizadora

05. (UEMA) As teorias da evolução procuram explicar como todas as espécies surgiram na Terra e como elas podem se transformar ao longo do tempo, originando outras espécies em virtude de suas semelhanças e suas diferenças. Podemos citar como exemplo a resistência à malária apresentada por pessoas portadoras de anemia falciforme. Neste tipo de doença, há deficiência no transporte de oxigênio pelas hemácias, inviabilizando o desenvolvimento do agente causador da malária.

A teoria evolutiva que explica a resistência à malária por parte dos portadores de anemia falciforme é conhecida como

  1. lei do uso e desuso.
  2. seleção industrial.
  3. seleção artificial.
  4. seleção natural.
  5. teoria sintética.

06. (UFGD) A anemia falciforme, uma das primeiras doenças hereditárias descritas afeta o alelo HbS que codifica uma das cadeias de hemoglobina. É comum o homozigoto HbS morrer ainda na infância em certas regiões. Homens e mulheres homozigotos HbS possuem uma anemia severa enquanto heterozigotos possuem uma anemia branda. Tanto homozigotos (HbS) como heterozigotos compartilham da alta resistência à malária. Isso ocorre, pois o heterozigoto produz as duas formas de hemoglobina: a normal e a falcêmica. Essa última desfavorece a infecção dos eritrócitos por Plasmodium sp.

Sabendo disso, e de acordo com seus conhecimentos biológicos, julgue os itens a seguir:

I. Indivíduos homozigotos HbA HbA são altamente propensos à infecção pela fase sexuada de Plasmodium sp em regiões endêmicas da malária.

II. Em um cruzamento entre dois heterozigotos: 25% dos filhos têm menores chances de sobreviver em relação aos demais em uma região sem qualquer histórico de malária.

III. Esse é um exemplo clássico de herança ligada ao sexo.

IV. Trata-se de uma herança codominante.

  1. Apenas I está correta
  2. I, II, III, IV estão corretas
  3. II, III, IV estão corretas
  4. II e IV estão corretas
  5. Apenas II está correta

07. (UEFS) O paciente mais velho (46 anos de idade) a ter recebido transplante de medula por anemia falciforme relata: “Minha mãe estava grávida de mim quando minha irmã de dois anos morreu com os sintomas clássicos de anemia falciforme. Quando eu tinha alguns meses de vida (1966), perceberam que eu também estava ficando pálido. Demorou para fazer o diagnóstico, pois minha irmã morreu sem ninguém saber que era anemia falciforme”. (LENHARO, 2013).

A análise das informações relatadas pelo paciente permite considerações, entre as quais se destaca a indicada em

  1. A hemoglobinopatia é decorrente da herança de genes localizados no cromossomo X.
  2. A mãe do paciente provavelmente possui genótipo HbA/HbS, sendo portadora de traço falcêmico.
  3. A ocorrência de anemia falciforme nas famílias segue um padrão de herança autossômica dominante.
  4. A probabilidade desse indivíduo ter filho com anemia falciforme independe do genótipo de sua parceira.
  5. Os pais do paciente, por serem nomais e terem tido dois filhos afetados têm uma probabilidade de 50% de terem um terceiro filho com anemia falciforme.

08. (UFPR) As figuras ao lado representam as frequências do alelo da anemia falciforme (à esquerda) e as regiões de endemia da malária (à direita), causada pelo Plasmodium falciparum, na África. Regiões com maior quantidade de indivíduos heterozigotos para a anemia falciforme são as que apresentam maior incidência de malária.

Por que se observa a coincidência das distribuições dessas duas situações?

  1. A malária atinge, preferencialmente, indivíduos com anemia falciforme.
  2. Os indivíduos heterozigotos têm menor chance de contrair o Plasmodium.
  3. Os indivíduos infectados pela malária têm maiores chances de desenvolver anemia falciforme.
  4. Os indivíduos heterozigotos têm maior chance de sobreviver quando infectados pelo Plasmodium.
  5. O Plasmodium invade apenas as hemácias em forma de foice, típica dos indivíduos com anemia falciforme.

09. (FGV-SP) A substituição de apenas um nucleotídeo no DNA pode representar uma grave consequência ao seu portador, em função de uma modificação de um componente molecular na proteína sintetizada a partir do trecho alterado.

É o caso da anemia falciforme, na qual a síntese da hemoglobina humana normal, Hb A, é parcial ou totalmente substituída pela hemoglobina falciforme mutante, Hb S, em decorrência da presença de um nucleotídeo com adenina no lugar de outro com timina

Tal mutação é responsável pela

  1. leitura incompleta do RNAm transcrito, codificador da hemoglobina.
  2. alteração na sequência de aminoácidos da hemoglobina sintetizada.
  3. modificação na sequência de nucleotídeos da hemoglobina das hemácias.
  4. tradução de uma hemoglobina mutante com um aminoácido a mais.
  5. transcrição de uma hemoglobina mutante com um aminoácido a menos.

10. (UECE) A anemia falciforme decorre de uma mutação específica no gene da beta-globina que é um tipo de hemoglobina denominada de hemoglobina S. Os indivíduos que possuem a hemoglobina S apresentam quadros periódicos de febre e dor, pelo fato de a hemoglobina S formar longos cristais quando as concentrações de oxigênio estão abaixo do normal. Então, essa cristalização interfere na estrutura da membrana celular, provocando o rompimento da célula. Adicionalmente, estas células que sofreram lise podem causar o entupimento das veias, levando o indivíduo à morte. Abaixo estão os dois pedaços do gene da beta globina. A primeira sequência corresponde ao DNA de um indivíduo normal; a segunda sequência corresponde ao DNA de um indivíduo com anemia falciforme.

1ª Sequência normal da hemoglobina:

ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTAC TGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG ACAGGTTTAAGGAGACCAATAGAAACTGGGCATGT

2ª Sequência da hemoglobina com a mutação – anemia falciforme:

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTAC TGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG ACAGGTTTAAGGAGACCAATAGAAACTGGGCATGT

Para a tradução desses genes, é (são) necessário(s)

  1. somente o mRNA.
  2. a fita complementar do DNA e o mRNA.
  3. somente o mRNA e o rRNA.
  4. DNA, mRNA; tRNA e rRNA.

Você acredita que o gabarito esteja incorreto? Avisa aí 😰| Email ou WhatsApp



Você acredita que o gabarito esteja incorreto? Avisa aí 😰| Email ou WhatsApp